Top » Catalog » SNPs » S9767

$18.00

S9767
[S9767]

S9767
HG19 Position: ChrY:7046793..7046793
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k1 (not listed)
Comments: Downstream L1335 > L1065 > S744 > S764
Forward Primer: S9767_F ACCCACCAGAACAAGGATTC
Reverse Primer: S9767_R CCCTTGGAGTCCTGACAAAG
Reviews

Customers who bought this product also purchased
DF41
DF41
Z17613
Z17613
R1b-L21 Super-Clade Orientation Panel
R1b-L21 Super-Clade Orientation Panel
Z251
Z251
S691
S691
L1335
L1335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies