Top » Catalog » SNPs » S9767

$18.00

S9767
[S9767]

S9767
HG19 Position: ChrY:7046793..7046793
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k1 (not listed)
Comments: Downstream L1335 > L1065 > S744 > S764
Forward Primer: S9767_F ACCCACCAGAACAAGGATTC
Reverse Primer: S9767_R CCCTTGGAGTCCTGACAAAG
Reviews

Customers who bought this product also purchased
L1335
L1335
S764
S764
A7367
A7367
Z39589
Z39589
S744
S744
FGC18441
FGC18441
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies