Top » Catalog » SNPs » S9767

$18.00

S9767
[S9767]

S9767
HG19 Position: ChrY:7178752..7178752
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k1 (not listed)
Comments: Downstream L1335 > L1065 > S744 > S764
Forward Primer: S9767_F ACCCACCAGAACAAGGATTC
Reverse Primer: S9767_R CCCTTGGAGTCCTGACAAAG
Reviews

Customers who bought this product also purchased
FGC32994
FGC32994
FGC45280
FGC45280
A861
A861
S7364
S7364
BY154
BY154
L743
L743
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies