Top » Catalog » SNPs » A7111

$18.00

A7111
[A7111]

A7111
hg38 Position: ChrY:2865404..2865404
Ancestral: A
Derived: C
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1a2a1a (not listed)
Comments: Downstream L233 > Y4252
Forward Primer: A7111_F CAGCTTTGCCACGAGGC
Reverse Primer: A7111_R TCCATGTTCACTGATGAACTGTAAG
Reviews

Customers who bought this product also purchased
Y33761
Y33761
Y4200
Y4200
L233
L233
I2a-CTS595 Panel
I2a-CTS595 Panel
FGC56815
FGC56815
CTS814
CTS814
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies