Top » Catalog » SNPs » A7111

$18.00

A7111
[A7111]

A7111
hg38 Position: ChrY:2865404..2865404
Ancestral: A
Derived: C
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1a2a1a (not listed)
Comments: Downstream L233 > Y4252
Forward Primer: A7111_F CAGCTTTGCCACGAGGC
Reverse Primer: A7111_R TCCATGTTCACTGATGAACTGTAAG
Reviews

Customers who bought this product also purchased
I2 Superclade Panel
I2 Superclade Panel
M223
M223
Y54081
Y54081
Y138217
Y138217
A19385
A19385
A19384
A19384
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies