Top » Catalog » SNPs » Z38664

$18.00

Z38664
[Z38664]

Z38664
hg38 Position: ChrY:8494733..8494733
Ancestral: C
Derived: T
Reference: Steve Fix (2015)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V13 > Z5016 > Z16988
Forward Primer: Z38664_F AGCACCCTAAGGATATGACTCTG
Reverse Primer: Z38664_R CCTCAAAACTAAGCTTTGTAAATGC
Reviews

Customers who bought this product also purchased
BY62310
BY62310
BY153593
BY153593
Y110616
Y110616
S19928
S19928
F14488
F14488
BY34282
BY34282
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies