Top » Catalog » SNPs » YP1696

$18.00

YP1696
[YP1696]

YP1696
hg38 Position: ChrY:13474331..13474331
Ancestral: T
Derived: G
Reference: YDNA-community (2015)
ISOGG Haplogroup: R1a
Comments: Downstream YP683
Forward Primer: YP1696_F GTTGCAGTGGGCTGACATAG
Reverse Primer: YP1696_R GATTGGTGCATTACCTGTTTCTC
Reviews

Customers who bought this product also purchased
Y11268
Y11268
BY182582
BY182582
YP683
YP683
Y58868
Y58868
YP575
YP575
YP1697
YP1697
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies