Top » Catalog » SNPs » S1026

$18.00

S1026
[S1026]

S1026
hg38 Position: ChrY:17090111..17090111
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: .
Forward Primer: S1026_F GCCTAAAGCATGGGATTCAG
Reverse Primer: S1026_R ATGATCCAGGAGCAGAGTGG
Reviews

Customers who bought this product also purchased
BY3927
BY3927
A7907
A7907
A5846
A5846
R1b-DF27 Panel
R1b-DF27 Panel
Y18513
Y18513
BY11922
BY11922
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies