Top » Catalog » SNPs » S1026

$18.00

S1026
[S1026]

S1026
hg38 Position: ChrY:17090111..17090111
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: .
Forward Primer: S1026_F GCCTAAAGCATGGGATTCAG
Reverse Primer: S1026_R ATGATCCAGGAGCAGAGTGG
Reviews

Customers who bought this product also purchased
FGC30631
FGC30631
BY11922
BY11922
FGC42169
FGC42169
L238
L238
U152
U152
DF19
DF19
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies