Top » Catalog » SNPs » S1026

$18.00

S1026
[S1026]

S1026
hg38 Position: ChrY:17090111..17090111
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: .
Forward Primer: S1026_F GCCTAAAGCATGGGATTCAG
Reverse Primer: S1026_R ATGATCCAGGAGCAGAGTGG
Reviews

Customers who bought this product also purchased
Y18437
Y18437
Y18513
Y18513
BY3927
BY3927
A7907
A7907
BY54624
BY54624
A5846
A5846
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies