Top » Catalog » SNPs » S11556

$18.00

S11556
[S11556]

S11556
hg38 Position: ChrY:8620487..8620487
Ancestral: G
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Below Z251
Forward Primer: S11556_F TCACCCAAAGACCCACCTAC
Reverse Primer: S11556_R GGCATTCATTGTGATGCTTG
Reviews

Customers who bought this product also purchased
FGC19534
FGC19534
A2201
A2201
BY3015
BY3015
M168
M168
P312
P312
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies