Top » Catalog » SNPs » S11556

$18.00

S11556
[S11556]

S11556
hg38 Position: ChrY:8620487..8620487
Ancestral: G
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Below Z251
Forward Primer: S11556_F TCACCCAAAGACCCACCTAC
Reverse Primer: S11556_R GGCATTCATTGTGATGCTTG
Reviews

Customers who bought this product also purchased
M343
M343
FGC34554
FGC34554
M9
M9
L21
L21
M168
M168
P312
P312
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x mtComplete
1 x A17442
1 x F2680
1 x F4380
1 x A16428
1 x F163
1 x F4079
$273.00
Haplogroup Info
Other products
Currencies