Top » Catalog » SNPs » S11556

$18.00

S11556
[S11556]

S11556
hg38 Position: ChrY:8620487..8620487
Ancestral: G
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Below Z251
Forward Primer: S11556_F TCACCCAAAGACCCACCTAC
Reverse Primer: S11556_R GGCATTCATTGTGATGCTTG
Reviews

Customers who bought this product also purchased
A7907
A7907
BY9005
BY9005
M173
M173
FT123856
FT123856
Y3550
Y3550
BY107550
BY107550
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies