Top » Catalog » SNPs » S11556

$18.00

S11556
[S11556]

S11556
hg38 Position: ChrY:8620487..8620487
Ancestral: G
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Below Z251
Forward Primer: S11556_F TCACCCAAAGACCCACCTAC
Reverse Primer: S11556_R GGCATTCATTGTGATGCTTG
Reviews

Customers who bought this product also purchased
FGC19534
FGC19534
A2201
A2201
BY3015
BY3015
M9
M9
L21
L21
M168
M168
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies