Top » Catalog » SNPs » A26390

$18.00

A26390
[A26390]

A26390
hg38 Position: ChrY:16899460..16899460
Ancestral: G
Derived: A
Reference: YSEQ (2020)
ISOGG Haplogroup: I2a
Comments: Below M423 > L621 > S17250
Forward Primer: A26390_F TCTCCCCATTCCATTACCTG
Reverse Primer: A26390_R CCAGTGGCCATACTTCAACC
Reviews

Customers who bought this product also purchased
I2a-M423 Panel
I2a-M423 Panel
Y5596
Y5596
FT14506
FT14506
PH908
PH908
YP206
YP206
S17250
S17250
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies