Top » Catalog » SNPs » A26390

$18.00

A26390
[A26390]

A26390
hg38 Position: ChrY:16899460..16899460
Ancestral: G
Derived: A
Reference: YSEQ (2020)
ISOGG Haplogroup: I2a
Comments: Below M423 > L621 > S17250
Forward Primer: A26390_F TCTCCCCATTCCATTACCTG
Reverse Primer: A26390_R CCAGTGGCCATACTTCAACC
Reviews

Customers who bought this product also purchased
PH908
PH908
YP206
YP206
S17250
S17250
Y43331
Y43331
CTS10228
CTS10228
Y4882
Y4882
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies