Top » Catalog » SNPs » S15627

$18.00

S15627
[S15627]

S15627
hg38 Position: ChrY:12084739..12084739
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a1c2a (not listed)
Comments: .
Forward Primer: S15627v2_F GGAAAATAAGTTCTTAGGTTGTCTGC
Reverse Primer: S15627v2_R GGATTGAATCTGTTTAATTCCAGC
Reviews

Customers who bought this product also purchased
JFS0026
JFS0026
L145
L145
JFS0029
JFS0029
P38
P38
JFS0071
JFS0071
M9
M9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies