Top » Catalog » SNPs » Y128293

$18.00

Y128293
[Y128293]

Y128293
hg38 Position: ChrY:14296373..14296373
Ancestral: C
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: Y128293_F AAATAAGCTAGCCTTTGACAATGC
Reverse Primer: Y128293_R CGACACCATAAAAACCTGCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies