Top » Catalog » SNPs » FGC52338

$18.00

FGC52338
[FGC52338]

FGC52338
hg38 Position: ChrY:7923333..7923333
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1a (not listed)
Comments: downstream FGC5 > FGC43122
Forward Primer: FGC52338_F GCATGGTATGTAAAAATACTTTCTGC
Reverse Primer: FGC52338_R GGCTCCCTGCTTGTGTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies