Top » Catalog » SNPs » FT346570

$18.00

FT346570
[FT346570]

FT346570
hg38 Position: ChrY:13152818..13152818
Ancestral: T
Derived: C
Reference: FTDNA (2020)
ISOGG Haplogroup: R1b
Comments: Below DF21 > S19938
Forward Primer: FT346570_F TTGGAGCCCATCTTCACTTC
Reverse Primer: FT346570_R TAGCTGGACTTCCTGGATCG
Reviews

Customers who bought this product also purchased
Prepaid Return Envelope
Prepaid Return Envelope
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies