Top » Catalog » SNPs » FGC42185

$18.00

FGC42185
[FGC42185]

FGC42185
hg38 Position: ChrY:11822193..11822193
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC42185_F TGTAGCCAAATCCACCTGTG
Reverse Primer: FGC42185_R GAATGGCAGAGGGAAAGTTATAGTAG
Reviews

Customers who bought this product also purchased
FGC42186
FGC42186
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies