Top » Catalog » SNPs » A28033

$18.00

A28033
[A28033]

A28033
hg38 Position: ChrY:13500013..13500013
Ancestral: C
Derived: A
Reference: Milenko Subotic (2020)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A28033_F CATATGTTGAGGGGGCTGAG
Reverse Primer: A28033_R ACTCCACCTGGCTTATCTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies