Top » Catalog » SNPs » F1449

$18.00

F1449
[F1449]

F1449
hg38 Position: ChrY:9017824..9017824
Ancestral: T
Derived: G
Reference: Yan Shi (2011)
ISOGG Haplogroup: not listed
Comments: Found in a hg O2 person. Likely a singleton. Also seen in E-V13
Forward Primer: F1449_F GAAGCGCCTTCTGTATCGTC
Reverse Primer: F1449_R GGATCATGAGTCCGCAGTG
Reviews

Customers who bought this product also purchased
Whole Genome Sequence
Whole Genome Sequence
DYS390
DYS390
YSEQ-Alpha
YSEQ-Alpha
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies