Top » Catalog » SNPs » FGC14554

$18.00

FGC14554
[FGC14554]

FGC14554
hg38 Position: ChrY:4714233..4714233
Ancestral: G
Derived: T
Reference: Full Genomes Inc (2014)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: Aka YFS153787
Forward Primer: FGC14554_F TTCTTTAGCATTTCTTATAGGACAGACTG
Reverse Primer: FGC14554_R AGCACTGAGATAACATATTTAAAGAGCTG
Reviews

Customers who bought this product also purchased
Z5018
Z5018
Z16242
Z16242
L1019
L1019
E1b-L1019 Goodrich Panel
E1b-L1019 Goodrich Panel
FGC14555
FGC14555
FGC19306
FGC19306
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies