Top » Catalog » SNPs » Y42509

$18.00

Y42509
[Y42509]

Y42509
hg38 Position: ChrY:16286346..16286346
Ancestral: C
Derived: G
Reference: YFull (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y42509_F AGTAGTCGGGACTACAGGCATG
Reverse Primer: Y42509_R TCCACATCATCATCATTTGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies