Top » Catalog » SNPs » FT346167

$18.00

FT346167
[FT346167]

FT346167
hg38 Position: ChrY:11969952..11969952
Ancestral: G
Derived: A
Reference: FTDNA (2020)
ISOGG Haplogroup: N
Comments: .
Forward Primer: FT346167_F GGCATCTCCAATACAGACAGC
Reverse Primer: FT346167_R GGTGTGCAAAACTGTATTCTTTTATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies