Top » Catalog » SNPs » Y205451

$18.00

Y205451
[Y205451]

Y205451
hg38 Position: ChrY:14478762..14478762
Ancestral: T
Derived: C
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: Below DF21 > DF5 > FGC3911 > L626
Forward Primer: Y205451_F GGGAGAATTAATAAATCAAGCAGC
Reverse Primer: Y205451_R CTCGGCTCACTGCAAGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies