Top » Catalog » SNPs » A28061

$18.00

A28061
[A28061]

A28061
hg38 Position: ChrY:14239387..14239387
Ancestral: G
Derived: T
Reference: David Reynolds (2020)
ISOGG Haplogroup: R1b
Comments: Below DF21 > DF5 > FGC3911 > L626
Forward Primer: A28061_F ACTGCCTGGAATAGGAATGC
Reverse Primer: A28061_R CACCTGCTCAAGCTGCAC
Reviews

Customers who bought this product also purchased
A28063
A28063
A28062
A28062
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies