Top » Catalog » SNPs » FGC37858

$18.00

FGC37858
[FGC37858]

FGC37858
hg38 Position: ChrY:20375619..20375619
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC37858_F TTAAGGAAAATTTCAATAAAATAGAATGTG
Reverse Primer: FGC37858_R TGCAGGATTTTAGTTTCTTTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies