Top » Catalog » SNPs » A11152

$18.00

A11152
[A11152]

A11152
hg38 Position: ChrY:15240919..15240919
Ancestral: A
Derived: C
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I1-Z58 CTS8647+ Z60-
Forward Primer: A11152_F TCAGTTTTCTTTTGAAAACATCATACTC
Reverse Primer: A11152_R CCTCTGAATGATTTTGACTCCAC
Reviews

Customers who bought this product also purchased
Z140
Z140
A14608
A14608
Z2539
Z2539
S337
S337
Z63
Z63
FGC23827
FGC23827
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies