Top » Catalog » SNPs » A11152

$18.00

A11152
[A11152]

A11152
hg38 Position: ChrY:15240919..15240919
Ancestral: A
Derived: C
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I1-Z58 CTS8647+ Z60-
Forward Primer: A11152_F TCAGTTTTCTTTTGAAAACATCATACTC
Reverse Primer: A11152_R CCTCTGAATGATTTTGACTCCAC
Reviews

Customers who bought this product also purchased
Z63
Z63
FGC23827
FGC23827
Z59
Z59
FGC23806
FGC23806
M253
M253
Z62
Z62
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies