Top » Catalog » SNPs » FGC3862

$18.00

FGC3862
[FGC3862]

FGC3862
hg38 Position: ChrY:13734832..13734832
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a1a2a1a1a1
Comments: Aka Y2404. below U106
Forward Primer: FGC3862_F TGAAGGTGGCATCTGACTCTC
Reverse Primer: FGC3862_R GTTGTTCTCTCTCGTGAGTGTTAAC
Reviews

Customers who bought this product also purchased
S493
S493
BY189328
BY189328
FGC17464
FGC17464
S12025
S12025
U106
U106
FGC17465
FGC17465
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies