Top » Catalog » SNPs » Z16433

$18.00

Z16433
[Z16433]

Z16433
hg38 Position: ChrY:15971955..15971955
Ancestral: C
Derived: A
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1e1a
Comments: downstream of Z255
Forward Primer: Z16433_F AAACATTTTGAAACAACAGGCTAAG
Reverse Primer: Z16433_R TTGCACTAAGCAAGGCAAAC
Reviews

Customers who bought this product also purchased
FGC33232
FGC33232
FGC33228
FGC33228
A5629
A5629
BY17769
BY17769
A6308
A6308
A5625
A5625
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies