Top » Catalog » SNPs » Z16950

$18.00

Z16950
[Z16950]

Z16950
hg38 Position: ChrY:21098114..21098114
Ancestral: T
Derived: C
Reference: Gregory Magoon et al. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1e (not listed)
Comments: downstream of Z255
Forward Primer: Z16950_F AATGCAAATGAATATCTGGTTCTC
Reverse Primer: Z16950_R AGCTAAACACTGGTTTGGTCTG
Reviews

Customers who bought this product also purchased
A5625
A5625
A10639
A10639
A15515
A15515
A10318
A10318
BY13571
BY13571
BY2576
BY2576
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies