Top » Catalog » SNPs » Z255

$18.00

Z255
[Z255]

Z255
hg38 Position: ChrY:13590895..13590895
Ancestral: T
Derived: C
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2c1e
Comments: beneath R-L21. upstream or approx. with L159.2
Forward Primer: Z255_F TCCAGACTGGGCAAGAAAAC
Reverse Primer: Z255_R CTCCAGCTTCCAGAAGTAACG
Reviews

Customers who bought this product also purchased
FGC11304
FGC11304
FGC11272
FGC11272
A12386
A12386
BY23383
BY23383
A11683
A11683
A10641
A10641
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies