Top » Catalog » SNPs » Z255

$18.00

Z255
[Z255]

Z255
hg38 Position: ChrY:13590895..13590895
Ancestral: T
Derived: C
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2c1e
Comments: beneath R-L21. upstream or approx. with L159.2
Forward Primer: Z255_F TCCAGACTGGGCAAGAAAAC
Reverse Primer: Z255_R CTCCAGCTTCCAGAAGTAACG
Reviews

Customers who bought this product also purchased
M269
M269
Y22342
Y22342
S928
S928
FGC41901
FGC41901
A16
A16
Z2195
Z2195
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies