Top » Catalog » SNPs » Z255

$18.00

Z255
[Z255]

Z255
hg38 Position: ChrY:13590895..13590895
Ancestral: T
Derived: C
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2c1e
Comments: beneath R-L21. upstream or approx. with L159.2
Forward Primer: Z255_F TCCAGACTGGGCAAGAAAAC
Reverse Primer: Z255_R CTCCAGCTTCCAGAAGTAACG
Reviews

Customers who bought this product also purchased
CTS5396
CTS5396
L1065
L1065
Y2890
Y2890
A8
A8
S5979
S5979
S6365
S6365
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies