Top » Catalog » SNPs » BY9700

$18.00

BY9700
[BY9700]

BY9700
hg38 Position: ChrY:20549643..20549643
Ancestral: T
Derived: C
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b
Comments: Below M81 > Z5009
Forward Primer: BY9700_F GCTTAAGAACGTGAGTTTTACCTTTG
Reverse Primer: BY9700_R CCAAGAGGAAATTATATATCCATGTAATTAAG
Reviews

Customers who bought this product also purchased
MZ270
MZ270
BY9699
BY9699
BY9698
BY9698
M5043
M5043
BY9757
BY9757
FT239268
FT239268
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies