Top » Catalog » SNPs » S170

$18.00

S170
[S170]

S170
hg38 Position: ChrY:20016683..20016683
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a1c2b1
Comments: Aka L47
Forward Primer: S170_F GCAGAACTCTAGTTTTGAAAGGATG
Reverse Primer: S170_R GGTATAAACAGAATCTGATGGCAG
Reviews

Customers who bought this product also purchased
S511
S511
S5918
S5918
R1b-L48 Panel
R1b-L48 Panel
S5940
S5940
BY18056
BY18056
L48
L48
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies