Top » Catalog » SNPs » S170

$18.00

S170
[S170]

S170
hg38 Position: ChrY:20016683..20016683
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a1c2b1
Comments: Aka L47
Forward Primer: S170_F GCAGAACTCTAGTTTTGAAAGGATG
Reverse Primer: S170_R GGTATAAACAGAATCTGATGGCAG
Reviews

Customers who bought this product also purchased
S5940
S5940
BY18056
BY18056
L48
L48
L200
L200
Y83097
Y83097
U106
U106
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies