Top » Catalog » SNPs » Z16330

$18.00

Z16330
[Z16330]

Z16330
hg38 Position: ChrY:15283808..15283808
Ancestral: C
Derived: G
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1k1b
Comments: downstream of L1335
Forward Primer: Z16330_F CCAGCACTCTGGGAAATTG
Reverse Primer: Z16330_R AGAATGTTGCATGGGTTTCC
Reviews

Customers who bought this product also purchased
PH367
PH367
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Z251
Z251
A5919
A5919
DF41
DF41
Z16500
Z16500
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies