Top » Catalog » SNPs » Z16330

$18.00

Z16330
[Z16330]

Z16330
hg38 Position: ChrY:15283808..15283808
Ancestral: C
Derived: G
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1k1b
Comments: downstream of L1335
Forward Primer: Z16330_F CCAGCACTCTGGGAAATTG
Reverse Primer: Z16330_R AGAATGTTGCATGGGTTTCC
Reviews

Customers who bought this product also purchased
A5919
A5919
DF41
DF41
Z16500
Z16500
Z39589
Z39589
S1026
S1026
DF49
DF49
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies