Top » Catalog » SNPs » S1911

$18.00

S1911
[S1911]

S1911
hg38 Position: ChrY:21003759..21003759
Ancestral: C
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a1c1a1 (not listed)
Comments: .
Forward Primer: S1911_F TTTGCTATCTGCTGGGTGTG
Reverse Primer: S1911_R AAGCCCATGGTGGTAAAATG
Reviews

Customers who bought this product also purchased
FGC39801
FGC39801
Y18100
Y18100
FGC11662
FGC11662
Z306
Z306
S5556
S5556
S5520
S5520
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies