Top » Catalog » SNPs » Y168313

$18.00

Y168313
[Y168313]

Y168313
hg38 Position: ChrY:19288878..19288878
Ancestral: G
Derived: C
Reference: YFull (2018)
ISOGG Haplogroup: I1
Comments: Below DF29 > Z140 > L338 > A375 > S2000
Forward Primer: Y168313_F GGTATATATCCAAAGAATTATAAATCATGCTC
Reverse Primer: Y168313_R CTAGAAACTGGGACATGCAAATC
Reviews

Customers who bought this product also purchased
Y141809
Y141809
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies