Top » Catalog » SNPs » Z45634

$18.00

Z45634
[Z45634]

Z45634
hg38 Position: ChrY:20517833..20517833
Ancestral: C
Derived: G
Reference: Ray Banks (2017)
ISOGG Haplogroup: G
Comments: Down from Z39674
Forward Primer: Z45634_F CCTTGCTACTATTGACCTTCAAGG
Reverse Primer: Z45634_R GTGCTCTGGCTGTAGAGGGTC
Reviews

Customers who bought this product also purchased
Z45635
Z45635
Z45632
Z45632
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies