Top » Catalog » SNPs » Z45635

$18.00

Z45635
[Z45635]

Z45635
hg38 Position: ChrY:20548693..20548693
Ancestral: A
Derived: C
Reference: Ray Banks (2017)
ISOGG Haplogroup: G
Comments: Down from Z39674
Forward Primer: Z45635_F AAGAGAGGTCCTAGTAGAAGAGCTAACC
Reverse Primer: Z45635_R ATTTTTTTTTTAGAGAGAGTGCATTCTC
Reviews

Customers who bought this product also purchased
Z45634
Z45634
Z45632
Z45632
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies