Top » Catalog » SNPs » M5012

$18.00

M5012
[M5012]

M5012
hg38 Position: ChrY:17236857..17236857
Ancestral: G
Derived: C
Reference: Underhill et al.
ISOGG Haplogroup: E
Comments:
Forward Primer: M5012_F CTGATTGCATACACAACCAATTG
Reverse Primer: M5012_R ATGAATTTGAGGTTTTCTCTTCTCTC
Reviews

Customers who bought this product also purchased
BY8888
BY8888
V22
V22
V38
V38
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
M5043
M5043
Z827
Z827
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies