Top » Catalog » SNPs » rs6119471

$18.00

rs6119471
[rs6119471]

rs6119471
hg38 Position: Chr20:34197406..34197406
Ancestral: C
Derived: G
Reference: dbSNP
ISOGG Haplogroup: none
Comments: ASIP
Forward Primer: rs6119471_F GAAGTAGCTGTACTAGACGGGATCC
Reverse Primer: rs6119471_R GCAAGCCTGACTCTGGTCTC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies