Top » Catalog » SNPs » S23035

$18.00

S23035
[S23035]

S23035
hg38 Position: ChrY:19243061..19243061
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of Z255
Forward Primer: S23035_F TTTCTAAGCCCGACCATCAG
Reverse Primer: S23035_R TTTGGCATGATGTTGTCAGG
Reviews

Customers who bought this product also purchased
A10639
A10639
A15515
A15515
A10318
A10318
BY13571
BY13571
A5625
A5625
A8449
A8449
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies