Top » Catalog » SNPs » Z8

$18.00

Z8
[Z8]

Z8
hg38 Position: ChrY:20029258..20029258
Ancestral: C
Derived: T
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1a
Comments: beneath L48. parallel to L47;downstream of Z7. upstream of Z1. Z11. Z12
Forward Primer: Z8_F AGAAGTACCATTTGACCTCCCC
Reverse Primer: Z8_R CCCTCCTCCTACCTTCCATTC
Reviews

Customers who bought this product also purchased
Y23209
Y23209
BY119
BY119
Y15633
Y15633
Y15883
Y15883
CTS7678
CTS7678
BY121
BY121
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies