Top » Catalog » SNPs » Z8

$18.00

Z8
[Z8]

Z8
hg38 Position: ChrY:20029258..20029258
Ancestral: C
Derived: T
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1a
Comments: beneath L48. parallel to L47;downstream of Z7. upstream of Z1. Z11. Z12
Forward Primer: Z8_F AGAAGTACCATTTGACCTCCCC
Reverse Primer: Z8_R CCCTCCTCCTACCTTCCATTC
Reviews

Customers who bought this product also purchased
BY20443
BY20443
Y67920
Y67920
BY152300
BY152300
BY153784
BY153784
BY121
BY121
S20321
S20321
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies