Top » Catalog » SNPs » rs28777

$18.00

rs28777
[rs28777]

rs28777
hg38 Position: Chr5:33958854..33958854
Ancestral: A
Derived: C
Reference: dbSNP
ISOGG Haplogroup: .
Comments: SLC45A2
Forward Primer: rs28777_F CATCAAACACTTGGGTTCAATG
Reverse Primer: rs28777_R TTGGGGAACAAAACAAGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies