Top » Catalog » SNPs » rs4959270

$18.00

rs4959270
[rs4959270]

rs4959270
hg38 Position: Chr6:457748..457748
Ancestral: C
Derived: A
Reference: dbSNP
ISOGG Haplogroup: .
Comments: LOC105374875
Forward Primer: rs4959270_F ATCATGAGAAATCTACCCCCAC
Reverse Primer: rs4959270_R AGCAAAAATAGGAAAAATGTACTCTAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies