Top » Catalog » SNPs » rs683

$18.00

rs683
[rs683]

rs683
hg38 Position: Chr9:12709305..12709305
Ancestral: A
Derived: C
Reference: dbSNP
ISOGG Haplogroup: .
Comments: TYRP1
Forward Primer: rs683_F TGAAGCTAACCAGCCTCTCC
Reverse Primer: rs683_R AATCATGCCAAAGATCTTCACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies